penguin essentials

'Everyone should read Down Girl. It should be distributed in schools and every board room, athletic department and legislative space' - Soraya Chemaly A transformative book on how misogyny works from a hugely influential thinker Misogyny is a hot topic, yet it's often misunderstood. What is misogyny exactly? Who deserves to be called a misogynist? How does misogyny contrast with sexism, and why is it prone to persist - or increase - even when sexist gender roles are waning? In Down Girl moral philosopher Kate Manne argues that misogyny should not be understood primarily in terms of the hatred or hostility some men feel toward all or most women. Rather, it is primarily about controlling, policing, punishing and exiling the "bad" women who challenge male dominance. And it is compatible with rewarding "the good ones" and singling out other women to serve as warnings to those who are out of order. An incredibly forensic analysis of the logic of misogyny from a brilliant thinker, Down Girl is essential reading for the #MeToo era.

'Rare and riveting' LYSE DOUCET 'Blistering . . . a genuinely remarkable achievement' THE TIMES 'Compulsively readable . . . unputdownable' JON LEE ANDERSON 'Dramatic, personal and often heartbreaking' GUARDIAN 'Rarely has a book been so timely . . . Essential reading' LINDSEY HILSUM 'One of the most perceptive books on modern Iran in years' NEW YORK TIMES The moving, riveting and immersive story of six Iranians who, together, lived the entire arc of modern Iranian history: from the promise of the 1979 revolution to its betrayal by the Islamic mafia state and a people's undying spirit of resistance. Fuelled by Iranians' dreams of social justice and political freedom, the 1979 revolution swept aside the shah's ailing, repressive monarchy. But in its place the revolution's leader Ayatollah Khomeini and his acolytes built a system that served his narrow Islamic fundamentalist faction and worsened every failing and brutality that had existed under the shah. In this landmark new book, award-winning journalists Bozorgmehr Sharafedin and Yeganeh Torbati tell the entwined stories of six Iranians, providing a powerful new lens on Iran's recent history in all its bitter twists and stubborn hope: . Mehdi Karroubi : a devotee of Khomeini, he rose to the heights of power on the wave of the revolution, before being cast out of its inner circle. . Hila Sedighi : a young activist, who gave voice through her poetry to her peers' hopes during the reform years and ultimately immortalised their shattered dreams. . Amir Moghadam : an ambitious government bureaucrat, who witnessed corruption and graft on a scale that impelled him to take enormous risks to expose the truth. . Said Rahmani : a successful global tech entrepreneur who returned to Iran to spark a start-up boom in his native country, and encountered a ruthless security state that wanted his company for itself. . Rozhin Yousefzadeh and Kosar Eftekhari : both born in the 1990s, they escaped their gendered destinies by leaving their hometowns for Tehran, where they joined a mass movement that confronted a ferocious state apparatus: the Woman Life Freedom protests. Each paid an enormous price. Through vivid and original reporting, Stolen Revolution offers a compulsively readable new story of Iran, centring ordinary Iranians' lives, whilst providing a visceral understanding of how life is actually lived under a modern authoritarian state. This is a harrowing story of power, corruption and greed - and those brave individuals who fought back. 'The definitive inside story of how the ideals behind Iran's revolution were subverted and crushed - and of the brave Iranians who still keep those dreams alive' CATHERINE BELTON, author of PUTIN'S PEOPLE 'Profoundly affecting . . . One of the most incisive works on Iranian society in a generation' SCOTT ANDERSON, author of KING OF KINGS 'Excellent . . . tells the tragic but often inspiring story of Iran over the last fifty years . . . Essential' JASON BURKE, author of THE REVOLUTIONISTS 'Extraordinarily powerful' JACK STRAW

*SHORTLISTED FOR THE WATERSTONES DEBUT FICTION PRIZE 2025* 'An irresistible read' YAEL VAN DER WOUDEN, Women's Prize-winning author of THE SAFEKEEP 'An intricately woven epic, Confessions is both intimate and expansive, a novel that teems with raw, hungry life' COLIN WALSH, author of KALA It is late September in 2001 and the walls of New York are papered over with photos of the missing. Cora Brady's father is there, the poster she made taped to columns and bridges. Her mother died long ago and now, orphaned on the cusp of adulthood, Cora is adrift and alone. Soon, a letter will arrive with the offer of a new life: far out on the ragged edge of Ireland, in the town where her parents were young, an estranged aunt can provide a home and fulfil a long-forgotten promise. There the story of Cora's family is hidden, and in her presence will begin to unspool... An essential, immersive debut from an astonishing new voice, Confessions traces the arc of three generations of women as they experience in their own time the irresistible gravity of the past: its love and tragedy, its mystery and redemption, and, in all things intended and accidental, the beauty and terrible shade of the things we do. 'Propulsive and utterly captivating . . . Airey has shades of the American novelists Donna Tartt and Jeffrey Eugenides in her style' IRISH TIMES 'A remarkable debut' MIRANDA COWLEY HELLER, bestselling author of THE PAPER PALACE 'A cool, bold image of female pain and liberation' GUARDIAN

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Learn to speak French in just 3 months with this practical language course for beginners! This language course in an easily portable book will teach you to speak French faster than you ever thought possible. Regular exercises and drills will reinforce your learning as you go, helping to build your confidence with your new language. The essentials of French grammar are clearly explained, while model sentences and word lists help you to learn and remember your new French vocabulary. Each chapter ends with a conversation in everyday French, based on a real-life scenario, which you can read aloud to practise your speaking skills. Intuitive pronunciation guides, using Hugo's unique "imitated pronunciation" system - which replaces French sounds with English syllables you're already familiar with - make sure that you're always confident with the pronunciation of new words. This guide also includes a mini bilingual dictionary for quick reference when you're learning or revising your new skills. Whether you're learning French for work or to feel more at home in a new country, this indispensable guide will give you confidence you need.

***THE INTERNATIONAL BESTSELLER: OVER 1 MILLION COPIES SOLD WORLDWIDE*** Are you tempted to go to business school? Save your money and read THE PERSONAL MBA instead . This bestselling business classic gives you everything you need to transform your business and your career. An MBA at a top business school is an enormous investment in time and cash. And if you don't want to work for a consulting firm or an investment bank, the chances are it simply isn't worth it. The Personal MBA gives you simple mental models for every subject that's key to commercial success. From the basics of products and marketing to the nuances of teamwork and systems, this book distils everything you need to know to take on the MBA graduates and win. 'File this book under: NO EXCUSES' Seth Godin 'No matter what they tell you, an MBA is not essential. If you combine reading this book with actually trying stuff, you'll be far ahead in the business game' Kevin Kelly, founder of Wired

An Instant Sunday Times Bestseller 'A profoundly urgent intervention' Naomi Klein From one of the most influential thinkers of our time, an enlightening, essential account of how a fear of gender is fuelling reactionary politics around the world Judith Butler, the ground-breaking philosopher whose work has redefined how we think about gender and sexuality, confronts the attacks on gender that have become central to right-wing movements today. Global networks have formed 'anti-gender ideology movements' dedicated to circulating a fantasy that gender is a dangerous threat to families, local cultures, civilization - and even 'man' himself. Inflamed by the rhetoric of public figures, this movement has sought to abolish reproductive justice, undermine protections against violence, and strip trans and queer people of their rights. But what, exactly, is so disturbing about gender? In this vital, courageous book, Butler carefully examines how 'gender' has become a phantasm for emerging authoritarian regimes, fascist formations and transexclusionary feminists, and the concrete ways in which this phantasm works. Operating in tandem with deceptive accounts of critical race theory and xenophobic panics about migration, the anti-gender movement demonizes struggles for equality and leaves millions of people vulnerable to subjugation. An essential intervention into one of the most fraught issues of our moment, Who's Afraid of Gender? is a galvanizing call to make a broad coalition with all those who struggle for equality and fight injustice. Imagining new possibilities for freedom and solidarity, Butler offers us an essentially hopeful work that is both timely and timeless.

RADIO 4 BOOK OF THE WEEK Economic thinking - about globalisation, climate change, immigration, austerity, automation and much more - in its most digestible form For decades, a single free market philosophy has dominated global economics. But this is bland and unhealthy - like British food in the 1980s, when bestselling author and economist Ha-Joon Chang first arrived in the UK from South Korea. Just as eating a wide range of cuisines contributes to a more interesting and balanced diet, so too is it essential we listen to a variety of economic perspectives. In Edible Economics, Chang makes challenging economic ideas more palatable by plating them alongside stories about food from around the world. He uses histories behind familiar food items - where they come from, how they are cooked and consumed, what they mean to different cultures - to explore economic theory. For Chang, chocolate is a life-long addiction, but more exciting are the insights it offers into post-industrial knowledge economies; and while okra makes Southern gumbo heart-meltingly smooth, it also speaks of capitalism's entangled relationship with freedom and unfreedom. Explaining everything from the hidden cost of care work to the misleading language of the free market as he cooks dishes like anchovy and egg toast, Gambas al Ajillo and Korean dotori mook, Ha-Joon Chang serves up an easy-to-digest feast of bold ideas. Myth-busting, witty and thought-provoking, Edible Economics shows that getting to grips with the economy is like learning a recipe: if we understand it, we can change it - and, with it, the world.

From the acclaimed author of John F. Kennedy: An Unfinished Life, the biography of one of America's greatest presidents, Franklin D. Roosevelt. 'Meticulously researched and authoritative, heroically objective and wide-angled ... Roosevelt is with us again in Dallek's outstanding cradle-to-grave study' Douglas Brinkley, Washington Post 'Assuredly the best single-volume Roosevelt biography' Eric Rauchway, The Times Literary Supplement 'Essential ... a master of the presidential biography captures Roosevelt's compassion and sense of solidarity' Greg Grandin, Guardian 'An insightful, incisive and intelligent one-volume work - and a pointed primer on how things in Washington get done. In a period defined by division, Dallek crafts a pointillist portrait of the four-term president, who knew almost intuitively how to reach consensus' Peter M. Gianotti, Newsday

Learn to crochet cables! Have you ever wanted to create a sweater with beautiful cables, but you didn't know how to knit? Now, in Contemporary Celtic Crochet, you can learn how to use basic crochet stitches to create the same stunning effect on sweater wraps, stoles, cardigans, and more. This book features easy projects, such as hats, scarves and device covers, and more difficult projects, including sweaters, wraps and blankets. Make the Hialeah Honey Baby Blankey to swaddle a newborn or create the Inisheer Sweater Wrap to stay cozy in cool weather. The Cables Meet Lace Cape is perfect for evenings out, and the Pennywhistler's Pack will let you carry your essentials on any day trip. These Celtic-inspired stitches and projects are the perfect addition to your crochet repertoire.

Discover football's astonishing hidden rules in The Numbers Game by Chris Anderson and David Sally *Fully updated with a new World Cup chapter* Football has always been a numbers game: 4-4-2, the big number 9 and 3 points for a win. But what if up until now we've been focusing on the wrong numbers? What if the numbers that really matter, the ones that hold the key to winning matches, are actually 2.66, 53.4, 50/50, and 0 > 1? What if managers only make a 15% difference? What if Chelsea should have bought Darren Bent? In this incisive, myth-busting book, Chris Anderson, former goalkeeper turned football statistics guru, and David Sally, former baseball pitcher turned behavioural economist, show that every shred of knowledge we can gather can help us to love football and understand it even more. You'll discover why stopping a goal is more valuable than scoring one, why corners should be taken short, and why it is better to improve your worst player than to buy a superstar. You'll never play, or watch, a game of football in quite the same way again. The Numbers Game is essential reading for football fans everywhere and will also appeal to readers who loved Moneyball and Freakonomics.

International Booker Prize finalist Winner of the International Prize for Arabic Fiction Brave and ingenious. The New York Times Gripping, darkly humorous . . . profound. Phil Klay, bestselling author and National Book Award winner for Redeployment Extraordinary . . . A devastating but essential read. Kevin Powers, bestselling author and National Book Award finalist for The Yellow Birds From the rubble-strewn streets of U.S.-occupied Baghdad, Hadi a scavenger and an oddball fixture at a local café collects human body parts and stitches them together to create a corpse. His goal, he claims, is for the government to recognize the parts as people and to give them proper burial. But when the corpse goes missing, a wave of eerie murders sweeps the city, and reports stream in of a horrendous-looking criminal who, though shot, cannot be killed. Hadi soon realizes he s created a monster, one that needs human flesh to survive first from the guilty, and then from anyone in its path. A prizewinning novel by Baghdad s new literary star (The New York Times), Frankenstein in Baghdad captures with white-knuckle horror and black humor the surreal reality of contemporary Iraq.

CALDECOTT HONOR BOOK NATIONAL BESTSELLER Adored by generations of readers, this gorgeously illustrated classic tells a tale of youth, curiosity, and delight as a little girl and her mother make unexpected friends while picking blueberries in the Maine countryside. One of The Atlantic’s 65 Essential Children’s Books “All the color and flavor of the sea and pine-covered Maine countryside.”—School Library Journal (starred review) Kuplink, kuplank, kuplunk! Sal and her mother are picking blueberries to can for the winter. But when Sal wanders to the other side of Blueberry Hill, she discovers a mama bear preparing for her own long winter. Meanwhile, Sal's mother is being followed by a small bear with a big appetite for berries! Will each mother go home with the right little one? With its expressive line drawings and gentle, humorous storytelling, Blueberries for Sal will have readers of all ages rooting for their adventurous protagonist to explore, reunite, and—of course—eat more blueberries!

IACP AWARD FINALIST Reimagine Italian-American cooking, with more than 125 recipes rich with flavor and nostalgia from the celebrated husband-and-wife chef team of Michelin-starred Don Angie in New York City. Every bit of warmth and hospitality that you feel when you walk into Don Angie pours out of every page of this magical book. Michael Symon ONE OF THE BEST COOKBOOKS OF THE YEAR: New York Post, Minneapolis Star Tribune, Food52, Epicurious, Taste of Home The words red sauce alone conjure images of an Italian-American table full of antipasti, both hot and cold, whisked off to make room for decadent baked pastas topped with molten cheese, all before a procession of chicken parm or pork chops all pizzaiola and we haven t even gotten to dessert. It s old-school cooking beloved by many and imbued with a deep sense of family. In Italian American, Angie Rito and Scott Tacinelli, the chefs of critically acclaimed Don Angie in New York City s West Village, reinvigorate the genre with a modern point of view that proudly straddles the line between Italian and American. They present family classics passed down through generations side-by-side with creative spins and riffs inspired by influences both old and new. These comforting dishes feel familiar but are far from expected, including their signature pinwheel lasagna, ribs glazed with orange and Campari, saucy shrimp parm meatballs, and a cheesy, bubbling gratin of broccoli rabe and sharp provolone. Full of family history and recipes that will inspire a new generation, Italian American provides an essential, spirited introduction to an unforgettable way of cooking.

'Masterly, hilarious, truly insightful' - Philip Hensher, The Spectator A Times Literary Supplement Book of the Year 2019 The last major collection of Nabokov's published material, Think, Write, Speak brings together a treasure trove of previously uncollected texts from across the author's extraordinary career. Each phase of his wandering life is included, from a precocious essay written while still at Cambridge in 1921, through his fame in the aftermath of the publication of Lolita to the final, fascinating interviews given shortly before his death in 1977. Introduced and edited by his biographer Brian Boyd, this is an essential work for anyone who has been drawn into Nabokov's literary orbit. Here he is at his most inspirational, curious, playful, misleading and caustic. The seriousness of his aesthetic credo, his passion for great writing and his mix of delight and dismay at his own, sudden global fame in the 1950s are all brilliantly delineated.

A balanced and thought-provoking guide to all the big questions about AI and ethics Can computers understand morality? Can they respect privacy? And what can we do to make AI safe and fair? The artificial intelligence revolution has begun. Today, there are self-driving cars on our streets, autonomous weapons in our armies, robot surgeons in our hospitals - and AI's presence in our lives will only increase. Some see this as the dawn of a new era in innovation and ease; others are alarmed by its destructive potential. But one thing is clear: this is a technology like no other, one that raises profound questions about the very definitions of human intelligence and morality. In Moral AI, world-renowned researchers in moral psychology, philosophy, and artificial intelligence - Jana Schaich Borg, Walter Sinnott-Armstrong and Vincent Conitzer - tackle these thorny issues head-on. Writing lucidly and calmly, they lay out the recent advances in this still nascent field, peeling away the exaggeration and misleading arguments. Instead, they offer clear examinations of the moral concerns at the heart of AI programs, from racial equity to personal privacy, fake news to autonomous weaponry. Ultimately, they argue that artificial intelligence can be built and used safely and ethically, but that its potential cannot be achieved without careful reflection on the values we wish to imbue it with. This is an essential primer for any thinking person.

'Why can't a human be more like a cat? That is the question threaded through this vivid patchwork of philosophy, fiction, history and memoir ... a wonderful mixture of flippancy and profundity, astringency and tenderness, wit and lament' Jane O'Grady, Daily Telegraph 'When I play with my cat, how do I know she is not passing time with me rather than I with her?' Montaigne There is no real evidence that humans ever 'domesticated' cats. Rather, it seems that at some point cats saw the potential value to themselves of humans. John Gray's wonderful new book is an attempt to get to grips with the philosophical and moral issues around the uniquely strange relationship between ourselves and these remarkable animals. Feline Philosophy draws on centuries of philosophy, from Montaigne to Schopenhauer, to explore the complex and intimate links that have defined how we react to and behave with this most unlikely 'pet'. At the heart of the book is a sense of gratitude towards cats as perhaps the species that more than any other - in the essential loneliness of our position in the world - gives us a sense of our own animal nature.

'Pay attention: If you are human, you must read this book' Jaron Lanier We all feel it: something is seriously wrong. Our attention-that essential ability to give our minds and senses to the world-is being trapped, gutted, and sold out from under us by an industry of immense technological and financial power. The heedless exploitation of this vital capacity by a handful of tech companies is harming us all, reducing our very selfhood to that which can be quantified, bought, and sold-and shaking the foundations of our democracy. To push back against this 'human fracking,"'we need more than individual willpower or isolated efforts. We need a movement of collective resistance. Such a movement is beginning to bloom, and in this radical, first-of-its-kind guide, The Friends of Attention show us how to join the fight. We meet welders, nurses, poets, and surfers, all of whom are engaged in attentional practices. We learn to seek out sanctuaries-theatres and museums, houses of worship, dance parties-where together we can take refuge from the frackers. Drawing on a rich legacy of critical intellectuals and the creative wisdom of diverse traditions, Attensity! takes our apocalyptic present, turns it on its head, and reveals new vistas of human flourishing.

'One of the most influential non-fiction books of the twentieth century' The New York Times When Betty Friedan produced The Feminine Mystique in 1963, she could not have realized how the discovery and debate of her contemporaries' general malaise would shake up society. Victims of a false belief system, these women were following strict social convention by loyally conforming to the pretty image of the magazines, and found themselves forced to seek meaning in their lives only through a family and a home. Friedan's controversial book about them - and every woman - would ultimately set Second Wave feminism in motion and begin the battle for equality. This groundbreaking and life-changing work remains just as powerful, important and true as it was nearly fifty years ago, and is essential reading both as a historical document and as a study of women living in a man's world.

WITH A NEW AFTERWORD The INSTANT New York Times bestseller Instant Los Angeles Times bestseller Finalist, Dayton Literary Peace Prize One of NPR's Books We Love One of Newsweek Staffers' Favorite Books of the Year Shortlisted for the Baillie Gifford Prize “In Nuclear War: A Scenario, Annie Jacobsen gives us a vivid picture of what could happen if our nuclear guardians fail….Terrifying.”—The Wall Street Journal There is only one scenario other than an asteroid strike that could end the world as we know it in a matter of hours: nuclear war. And one of the triggers for that war would be a nuclear missile inbound toward the United States. Every generation, a journalist has looked deep into the heart of the nuclear military establishment: the technologies, the safeguards, the plans, and the risks. These investigations are vital to how we understand the world we really live in—where one nuclear missile will beget one in return, and where the choreography of the world’s end requires massive decisions made on seconds’ notice with information that is only as good as the intelligence we have. Pulitzer Prize finalist Annie Jacobsen’s Nuclear War: A Scenario explores this ticking-clock scenario, based on dozens of exclusive new interviews with military and civilian experts who have built the weapons, have been privy to the response plans, and have been responsible for those decisions should they have needed to be made. Nuclear War: A Scenario examines the handful of minutes after a nuclear missile launch. It is essential reading, and unlike any other book in its depth and urgency.

From the acclaimed bestselling author and self-help legend 'She's so good, Brené Brown, at finding the language to articulate collective feeling' Dolly Alderton 'A wonderful book: urgent, essential and fun to read. I couldn't put it down, and it continues to resonate with me' - Seth Godin Every time we are faced with change, no matter how great or small, we also face risk. We feel uncertain and exposed. We feel vulnerable. Most of us try to fight those feelings - or feel guilt for feeling them in the first place. In a powerful new vision Dr Brené Brown challenges everything we think we know about vulnerability, and dispels the widely accepted myth that it's a weakness. She argues that, in truth, vulnerability is strength and when we shut ourselves off from vulnerability - from revealing our true selves - we distance ourselves from the experiences that bring purpose and meaning to our lives. Daring Greatly is the culmination of 12 years of groundbreaking social research, across every area of our lives including home, relationships, work, and parenting. It is an invitation to be courageous; to show up and let ourselves be seen, even when there are no guarantees. This is vulnerability. This is daring greatly.

The first great German novel - an extraordinary recreation of the horrors of the Thirty Years War, written by a veteran of the conflict First published in 1668, Simplicissimus tells the picaresque, brilliantly described adventures of a boy swept up in the Thirty Years War and the terrible things that he experiences. Some of it is realistic, some fantastical but the overall effect is an unmatched picture of Europe torn apart by an endless, sadistic, futile war from which nobody can escape. The Adventures of Simplicius Simplicissimus was rediscovered in twentieth-century Germany where the book's grim message as a story of war in all of its horror and absurdity resonated and the book is now established as one of the essential works of German literature.

The #1 New York Times bestseller that has all America talking, from the author of the highly anticipated Inside the Box: How Constraints Make Us Better. "The most important business-and parenting-book of the year." -Forbes "Urgent and important. . . an essential read for bosses, parents, coaches, and anyone who cares about improving performance." -Daniel H. Pink Shortlisted for the Financial Times/McKinsey Business Book of the Year Award Plenty of experts argue that anyone who wants to develop a skill, play an instrument, or lead their field should start early, focus intensely, and rack up as many hours of deliberate practice as possible. If you dabble or delay, you'll never catch up to the people who got a head start. But a closer look at research on the world's top performers, from professional athletes to Nobel laureates, shows that early specialization is the exception, not the rule. David Epstein examined the world's most successful athletes, artists, musicians, inventors, forecasters and scientists. He discovered that in most fields-especially those that are complex and unpredictable-generalists, not specialists, are primed to excel. Generalists often find their path late, and they juggle many interests rather than focusing on one. They're also more creative, more agile, and able to make connections their more specialized peers can't see. Provocative, rigorous, and engrossing, Range makes a compelling case for actively cultivating inefficiency. Failing a test is the best way to learn. Frequent quitters end up with the most fulfilling careers. The most impactful inventors cross domains rather than deepening their knowledge in a single area. As experts silo themselves further while AI threatens the jobs once reserved for highly focused humans, people who think broadly and embrace diverse experiences and perspectives will increasingly thrive.

Depicts a tired penguin clutching a steaming coffee mug, with the bold text 'But First Coffee'. Captures the essential morning routine for caffeine lovers. Embrace the pre-caffeine struggle with this funny penguin graphic. Designed for coffee drinkers, early risers, and those who cherish their morning coffee. Doppelwandig isoliert: hält Getränke heiß oder kalt Edelstahl, BPA-frei Auslaufsicherer Deckel mit transparentem Schieberegler

Mycelium Running is a manual for the mycological rescue of the planet. That s right: growing more mushrooms may be the best thing we can do to save the environment, and in this groundbreaking text from mushroom expert Paul Stamets, you ll find out how.   The basic science goes like this: Microscopic cells called mycelium --the fruit of which are mushrooms--recycle carbon, nitrogen, and other essential elements as they break down plant and animal debris in the creation of rich new soil. What Stamets has discovered is that we can capitalize on mycelium s digestive power and target it to decompose toxic wastes and pollutants (mycoremediation), catch and reduce silt from streambeds and pathogens from agricultural watersheds (mycofiltration), control insect populations (mycopesticides), and generally enhance the health of our forests and gardens (mycoforestry and myco-gardening).   In this comprehensive guide, you ll find chapters detailing each of these four exciting branches of what Stamets has coined mycorestoration, as well as chapters on the medicinal and nutritional properties of mushrooms, inoculation methods, log and stump culture, and species selection for various environmental purposes. Heavily referenced and beautifully illustrated, this book is destined to be a classic reference for bemushroomed generations to come.

FROM THE BESTSELLING AUTHOR OF EAST AND FRESH INDIA An essential addition to any cookbook collection and the perfect foodie gift, it will change the way they cook, eat and think about Indian food forever. ________________________________ True Indian food isn't like the stuff you get at your local curry house. In MADE IN INDIA, Guardian columnist Meera Sodha introduces Britain to the food she grew up eating here every day - food that's fresh, vibrant and surprisingly easy to make. In this collection, Meera serves up a feast of over 130 delicious and easy-to-follow recipes collected from three generations of her family including: CLASSIC STREET FOOD - Chilli Paneer and Beetroot and Feta Samosas FRAGRANT CURRIES - Spinach and Salmon and Cinnamon Lamb Curry COLOURFUL SIDE DISHES - Pomegranate and Mint Raita and Kachumbar Salad MOUTH-WATERING PUDDINGS - Mango, Lime Passion Fruit Jelly and Pistachio and Saffron Kulfi With an additional contents to help you find First-Timer Recipes , 30-Minute Midweek Meals , Kid-Friendly Cooking and Store-Cupboard Curries , there's something tasty for every situation. This book is for anyone who loves authentic Indian food and wants to learn how to make it themselves. ________________________________ 'Full of real charm, personality, love and garlic' Yotam Ottolenghi 'Wonderful, vibrant . . . deeply personal food, alive and authentic - the best sort - and, frankly, I want to cook everything in this book' Nigella Lawson

From the author of the multi-million copy bestseller The 48 Laws of Power and The Laws of Human Nature, a mesmerizing handbook on seduction: the most subtle and effective form of power. This is the only authorized paperback edition in the US.   When raised to the level of art, seduction, an indirect and subtle form of power, has toppled empires, won elections and enslaved great minds. Immerse yourself in the twenty-four maneuvers and strategies of the seductive process, the ritual by which a seducer gains mastery over his target. Understand how to "Poeticize Your Presence," Keep them in Suspense What Comes Next and Master the Art of the Bold Move . Every bit as essential as The 48 Laws of Power, The Art of Seduction is an indispensable primer of persuasion that reveals one of history's greatest weapons and the ultimate form of power.

"... essential guide to the gods, monsters, and creatures from the show, based on the beloved #1 New York Times bestselling series by Rick Riordan."--Provided by publisher.

“Masterful. The Anthropocene Reviewed is a beautiful, timely book about the human condition—and a timeless reminder to pay attention to your attention.” —Adam Grant, #1 bestselling author of Think Again and host of the podcast Re:Thinking The instant #1 bestseller from John Green, author of The Fault in Our Stars and Turtles All the Way Down, is now available in paperback with two brand-new essays! “Gloriously personal and life-affirming. The perfect book for right now.” —People “Essential to the human conversation.” —Library Journal, starred review The Anthropocene is the current geologic age, in which humans have profoundly reshaped the planet and its biodiversity. In this remarkable symphony of essays, bestselling author John Green reviews different facets of the human-centered planet on a five-star scale—from the QWERTY keyboard and sunsets to Canada geese and Penguins of Madagascar. Funny, complex, and rich with detail, the reviews chart the contradictions of contemporary humanity. John Green’s gift for storytelling shines throughout this masterful collection. The Anthropocene Reviewed is an open-hearted exploration of the paths we forge and an unironic celebration of falling in love with the world.

RADIO 4 BOOK OF THE WEEK Economic thinking - about globalisation, climate change, immigration, austerity, automation and much more - in its most digestible form For decades, a single free market philosophy has dominated global economics. But this is bland and unhealthy - like British food in the 1980s, when bestselling author and economist Ha-Joon Chang first arrived in the UK from South Korea. Just as eating a wide range of cuisines contributes to a more interesting and balanced diet, so too is it essential we listen to a variety of economic perspectives. In Edible Economics, Chang makes challenging economic ideas more palatable by plating them alongside stories about food from around the world. He uses histories behind familiar food items - where they come from, how they are cooked and consumed, what they mean to different cultures - to explore economic theory. For Chang, chocolate is a life-long addiction, but more exciting are the insights it offers into post-industrial knowledge economies; and while okra makes Southern gumbo heart-meltingly smooth, it also speaks of capitalism's entangled relationship with freedom and unfreedom. Explaining everything from the hidden cost of care work to the misleading language of the free market as he cooks dishes like anchovy and egg toast, Gambas al Ajillo and Korean dotori mook, Ha-Joon Chang serves up an easy-to-digest feast of bold ideas. Myth-busting, witty and thought-provoking, Edible Economics shows that getting to grips with the economy is like learning a recipe: if we understand it, we can change it - and, with it, the world.