Suche verfeinern
Filtern
Alles löschen
Kategorie
✓Preis
✓Marke
✓Verkäufer
✓Deine Suche ergab leider keine Ergebnisse. Bitte ändere die zuletzt verwendeten Filter und versuche es erneut.
Anzeige
Zeigt 211 - 240 von 754 Ergebnissen
Filtern
Sortieren:
Beste Treffer
Beste Treffer
Preis: niedrig bis hoch
Preis: hoch bis niedrig

Penguin Books Ltd Humble Pi A1050576332
**The First Ever Maths Book to be a No.1 Bestseller** 'Wonderful ... superb' Daily Mail What makes a bridge wobble when it's not meant to? Billions of dollars mysteriously vanish into thin air? A building rock when its resonant frequency matches a gym class leaping to Snap's 1990 hit I've Got The Power? The answer is maths. Or, to be precise, what happens when maths goes wrong in the real world. As Matt Parker shows us, our modern lives are built on maths: computer programmes, finance, engineering. And most of the time this maths works quietly behind the scenes, until ... it doesn't. Exploring and explaining a litany of glitches, near-misses and mishaps involving the internet, big data, elections, street signs, lotteries, the Roman empire and a hapless Olympic shooting team, Matt Parker shows us the bizarre ways maths trips us up, and what this reveals about its essential place in our world. Mathematics doesn't have good 'people skills', but we would all be better off, he argues, if we saw it as a practical ally. This book shows how, by making maths our friend, we can learn from its pitfalls. It also contains puzzles, challenges, geometric socks, jokes about binary code and three deliberate mistakes. Getting it wrong has never been more fun.
Sofort per Download lieferbar
9,49€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Rememberings A1059361919
THE LANDMARK MEMOIR OF A GLOBAL MUSIC ICON SHORTLISTED FOR THE IRISH BOOK AWARDS 2021 Sinéad O'Connor's voice and trademark shaved head made her famous by the age of twenty-one. Her recording of Prince's 'Nothing Compares 2 U' made her a global icon. She outraged millions when she tore up a photograph of Pope John Paul II on American television. O'Connor was unapologetic and impossible to ignore, calling out hypocrisy wherever she saw it. She remained that way for over three decades. In her acclaimed No 1 bestselling memoir Rememberings, O'Connor told her story - the heartache of growing up in a family falling apart; her early forays into the Dublin music scene; her adventures and misadventures in the world of sex, drugs and rock'n'roll; the fulfilment of being a mother; her ongoing spiritual quest - and through it all, her abiding passion for music. Rememberings is intimate, replete with candid anecdotes and full of hard-won insights. It is a unique and remarkable chronicle by a unique and remarkable artist. ***** 'Inspiring, liberating, hilarious and fascinating' Irish Times 'Beautifully observed ... lyrical, funny and anguished' Guardian 'Her voice on the page is as fearless, riveting and unforgettable as her voice in song. The cadence alone is hypnotic, her story essential. Rememberings is a must-read' Michael Stipe 'So good, you'll want to read it twice' Sunday Independent 'A soul-bearing, brutally honest account of an extraordinary life' BBC Online 'Tremendous . . . fierce and funny' Sunday Times Books of the Year
Sofort per Download lieferbar
10,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Women Without Men A1075100867
Longlisted for the International Booker Prize 2026 The internationally acclaimed masterpiece from one of Iran's most influential writers - a powerful and essential tale of female freedom 'The best feminist novel I know. It's thrilling, beautiful and hilarious' Johanne Lykke Holm 'A courageous, talented woman, and above all, a great writer' Marjane Satrapi, author of Persepolis Women Without Men traces the interwoven destinies of five women - including a wealthy middle-aged housewife, a sex worker and a schoolteacher - as they arrive by different paths to live together in an abundant garden on the outskirts of Tehran. Drawing on elements of Islamic mysticism and recent Iranian history, this unforgettable novel depicts women escaping the narrow confines of family and society, and imagines their future living in a world without men. Translated from Persian by Faridoun Farrokh
Sofort per Download lieferbar
8,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Publishing Group Conquering Infertility A1031746389
A groundbreaking guide to overcoming infertility that offers support, hope, and practical strategies for couples to improve their chances of becoming pregnant. Infertility is a heartbreaking condition that affects millions of American couples each year. It causes tremendous stress, can trigger debilitating sadness and depression, and can tear a marriage to shreds. Harvard psychologist Dr. Alice Domar-whom Vogue calls the "Fertility Goddess"-uses innovative mind/body techniques she has perfected at her clinic to help infertile couples not only regain control over their lives, but also boost their chances of conceiving. This exceptional guide also explores options like IVF, adoption, and surrogacy, helping couples navigate their unique fertility journey, as well as providing strategies for managing the stress to a relationship that infertility issues can cause. With compassionate advice and evidence-based insights, Conquering Infertility provides an essential resource for coping with infertility with a positive mindset and helps carve a path toward a rich, full, happy life.
Sofort per Download lieferbar
13,49€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Economy Gastronomy A1057478570
Learn how to eat better and spend less with deliciously easy recipes 'Delicious, thrifty, inspiring' GUARDIAN Featuring over 100 mouth-watering recipes and practical tips, Economy Gastronomy will help you to cook simple, better food, and along the way save you a lot of money _______ With this essential cookery companion, you will learn how to . . . - Get two, or even three, meals out of one basic ingredient - Turn leftovers into new and exciting dishes - Stock your cupboards so there's always a meal in the house - Shop seasonally, freeze and store food - Plan your meals and shrink your food bills With breakfasts, lunch, dinner, snack and treat ideas, you'll be making luxurious meals without spending a fortune or discarding surplus food in no time. Recipes include: - Caramelised onion and Cheshire cheese tart - Onion bhajis, tarka dahl and almond rice - Spinach, ham and ricotta gnocchi - Chinese-style crispy duck Filled with money-saving hacks and no-nonsense recipes, Economy Gastronomy will teach you how to use and spend less, without scrimping on flavour.
Sofort per Download lieferbar
12,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Slow Productivity A1069304547
THE SUNDAY TIMES BESTSELLER and Best Book of 2024 for the Economist, Independent, and NPR ' Brilliant and timely' - Oliver Burkeman, author of Four Thousand Weeks From the New York Times bestselling author of Digital Minimalism and one of the world's top productivity experts, a groundbreaking philosophy for creating great work at a sustainable pace. Hustle culture. Burnout. Quiet quitting. Today we're either sacrificing ourselves on the altar of success or we're rejecting the idea of ambition entirely. But it doesn't have to be all or nothing. There is a way to create meaningful work as part of a balanced life, and it's called 'slow productivity'. Coined by Cal Newport, the bestselling author of Deep Work and Digital Minimalism, slow productivity is a revolutionary philosophy based on three simple principles: 1. Do fewer things. 2. Work at a natural pace. 3. Obsess over quality. Examining the stories and habits of ancient and modern scientists, philosophers, artists and scholars who worked in this way, Newport reveals just how transformative the slow productivity approach can be to producing a meaningful body of work. From managing your energy according to the season, to identifying which projects to pursue and which to set aside, to building a schedule that yields maximum output with minimum stress, this timely and essential book will revolutionise how you work, helping you to accomplish great things at a more humane pace. 'Intriguing and intelligent' - The Times The US Amazon Editors' #1 pick in Business and Leadership
Sofort per Download lieferbar
14,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Breath A1056499490
AN UPDATED EDITION OF THE PHENOMENAL INTERNATIONAL BESTSELLER - 3 MILLION COPIES SOLD WORLDWIDE AS HEARD ON STEVEN BARTLETT'S 'DIARY OF A CEO' 'Who would have thought something as simple as changing the way we breathe could be so revolutionary for our health, from snoring to allergies to immunity? A fascinating book, full of dazzling revelations' Dr Rangan Chatterjee There is nothing more essential to our health and wellbeing than breathing: take air in, let it out, repeat 25,000 times a day. Yet, as a species, humans have lost the ability to breathe correctly, with grave consequences. In Breath, a book that has changed countless lives, James Nestor travels the world to discover the hidden science behind ancient breathing practices, discovering that if we make even slight adjustments to the way we inhale and exhale, we can: Jump-start athletic performance Reduce anxiety and stress, and boost productivity Halt snoring, allergies, asthma and autoimmune disease Ease headaches and sinus problems None of this should be possible, and yet it is. Drawing on thousands of years of ancient wisdom and cutting-edge studies in pulmonology, psychology, biochemistry and human physiology, Breath turns the conventional wisdom of what we thought we knew about our most basic biological function on its head. You will never breathe the same again. *Cover and copy may vary*
Sofort per Download lieferbar
9,49€
Versand: frei!
Zum Shop
buecher.de

Penguin Publishing Group Crochet Stitch Dictionary A1028779324
Great for new and experienced crocheters alike, Crochet Stitch Dictionary offers 200 stitches with detailed written, charted, and photographed instructions. This essential book presents 10 color-coded stitch sections: Basic stitches, Fans & Shells, Bobbles & Clusters, Spike stitches, Post stitches, Mesh & Filet, Cable stitches, Tunisian stitches, and more! Learn each stitch with written, charted, and step-by-step photo instructions that clearly explain where the yarn goes each step of the way. In addition, each stitch pattern shows a large finished swatch in actual size. You'll enjoy the colorful and eye-catching "candy-box" sampler pages that start every section. Crochet Stitch Dictionary offers excellent useful instruction and inspiration for all crocheters.
2 - 3 Wochen
25,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Women Without Men A1075110075
Longlisted for the International Booker Prize 2026 The internationally acclaimed masterpiece from one of Iran's most influential writers - a powerful and essential tale of female freedom 'The best feminist novel I know. It's thrilling, beautiful and hilarious' Johanne Lykke Holm 'A courageous, talented woman, and above all, a great writer' Marjane Satrapi, author of Persepolis Women Without Men traces the interwoven destinies of five women - including a wealthy middle-aged housewife, a sex worker and a schoolteacher - as they arrive by different paths to live together in an abundant garden on the outskirts of Tehran. Drawing on elements of Islamic mysticism and recent Iranian history, this unforgettable novel depicts women escaping the narrow confines of family and society, and imagines their future living in a world without men. Translated from Persian by Faridoun Farrokh
Sofort lieferbar
13,89€
Versand: frei!
Zum Shop
buecher.de

Penguin Books UK Eight Dates A1055668156
What really makes a relationship work? How can we stay interested in our partner for ever? How can we be happier in our marriage? Doctors John and Julie Gottman have spent over three decades studying the habits of 3000 couples. Within 10 minutes of meeting a couple, they can predict who will stay happily together or who will split up, with 94% accuracy. Based on their findings on the ingredients to a happy, lasting love life, they have now created an easy series of eight dates, spanning: - commitment & trust - conflict resolution - intimacy & sex - fun & adventure - work & money - family values - growth & spirituality - goals & aspirations Eight Dates draws on rigorous scientific and psychological research about how we fall in love using case studies of real-life couples whose relationships have improved after committing time to each other and following the dates. Full of innovative exercises and conversation starters to explore ways to deepen each aspect of the relationship, Eight Dates is an essential resource that makes a relationship fulfilling. 'Can a marriage really be understood? Yes it can. Gottman shows us how' Malcolm Gladwell, author of Blink
Sofort lieferbar
16,59€
Versand: frei!
Zum Shop
buecher.de

Penguin LLC US Dopamine Nation A1063140472
INSTANT NEW YORK TIMES and LOS ANGELES TIMES BESTSELLER “Brilliant . . . riveting, scary, cogent, and cleverly argued.”—Beth Macy, author of Dopesick This book is about pleasure. It’s also about pain. Most important, it’s about how to find the delicate balance between the two, and why now more than ever finding balance is essential. We’re living in a time of unprecedented access to high-reward, high-dopamine stimuli: drugs, food, news, gambling, shopping, gaming, texting, sexting, Facebooking, Instagramming, YouTubing, tweeting . . . The increased numbers, variety, and potency is staggering. The smartphone is the modern-day hypodermic needle, delivering digital dopamine 24/7 for a wired generation. As such we’ve all become vulnerable to compulsive overconsumption. In Dopamine Nation, Dr. Anna Lembke, psychiatrist and author, explores the exciting new scientific discoveries that explain why the relentless pursuit of pleasure leads to pain . . . and what to do about it. Condensing complex neuroscience into easy-to-understand metaphors, Lembke illustrates how finding contentment and connectedness means keeping dopamine in check. The lived experiences of her patients are the gripping fabric of her narrative. Their riveting stories of suffering and redemption give us all hope for managing our consumption and transforming our lives. In essence, Dopamine Nation shows that the secret to finding balance is combining the science of desire with the wisdom of recovery.
Sofort lieferbar
13,09€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Down Girl A1052851079
'Everyone should read Down Girl. It should be distributed in schools and every board room, athletic department and legislative space' - Soraya Chemaly A transformative book on how misogyny works from a hugely influential thinker Misogyny is a hot topic, yet it's often misunderstood. What is misogyny exactly? Who deserves to be called a misogynist? How does misogyny contrast with sexism, and why is it prone to persist - or increase - even when sexist gender roles are waning? In Down Girl moral philosopher Kate Manne argues that misogyny should not be understood primarily in terms of the hatred or hostility some men feel toward all or most women. Rather, it is primarily about controlling, policing, punishing and exiling the "bad" women who challenge male dominance. And it is compatible with rewarding "the good ones" and singling out other women to serve as warnings to those who are out of order. An incredibly forensic analysis of the logic of misogyny from a brilliant thinker, Down Girl is essential reading for the #MeToo era.
Sofort lieferbar
14,49€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Stolen Revolution A1076776882
'Rare and riveting' LYSE DOUCET 'Blistering . . . a genuinely remarkable achievement' THE TIMES 'Compulsively readable . . . unputdownable' JON LEE ANDERSON 'Dramatic, personal and often heartbreaking' GUARDIAN 'Rarely has a book been so timely . . . Essential reading' LINDSEY HILSUM 'One of the most perceptive books on modern Iran in years' NEW YORK TIMES The moving, riveting and immersive story of six Iranians who, together, lived the entire arc of modern Iranian history: from the promise of the 1979 revolution to its betrayal by the Islamic mafia state and a people's undying spirit of resistance. Fuelled by Iranians' dreams of social justice and political freedom, the 1979 revolution swept aside the shah's ailing, repressive monarchy. But in its place the revolution's leader Ayatollah Khomeini and his acolytes built a system that served his narrow Islamic fundamentalist faction and worsened every failing and brutality that had existed under the shah. In this landmark new book, award-winning journalists Bozorgmehr Sharafedin and Yeganeh Torbati tell the entwined stories of six Iranians, providing a powerful new lens on Iran's recent history in all its bitter twists and stubborn hope: . Mehdi Karroubi : a devotee of Khomeini, he rose to the heights of power on the wave of the revolution, before being cast out of its inner circle. . Hila Sedighi : a young activist, who gave voice through her poetry to her peers' hopes during the reform years and ultimately immortalised their shattered dreams. . Amir Moghadam : an ambitious government bureaucrat, who witnessed corruption and graft on a scale that impelled him to take enormous risks to expose the truth. . Said Rahmani : a successful global tech entrepreneur who returned to Iran to spark a start-up boom in his native country, and encountered a ruthless security state that wanted his company for itself. . Rozhin Yousefzadeh and Kosar Eftekhari : both born in the 1990s, they escaped their gendered destinies by leaving their hometowns for Tehran, where they joined a mass movement that confronted a ferocious state apparatus: the Woman Life Freedom protests. Each paid an enormous price. Through vivid and original reporting, Stolen Revolution offers a compulsively readable new story of Iran, centring ordinary Iranians' lives, whilst providing a visceral understanding of how life is actually lived under a modern authoritarian state. This is a harrowing story of power, corruption and greed - and those brave individuals who fought back. 'The definitive inside story of how the ideals behind Iran's revolution were subverted and crushed - and of the brave Iranians who still keep those dreams alive' CATHERINE BELTON, author of PUTIN'S PEOPLE 'Profoundly affecting . . . One of the most incisive works on Iranian society in a generation' SCOTT ANDERSON, author of KING OF KINGS 'Excellent . . . tells the tragic but often inspiring story of Iran over the last fifty years . . . Essential' JASON BURKE, author of THE REVOLUTIONISTS 'Extraordinarily powerful' JACK STRAW
Sofort per Download lieferbar
14,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Confessions A1071596580
*SHORTLISTED FOR THE WATERSTONES DEBUT FICTION PRIZE 2025* 'An irresistible read' YAEL VAN DER WOUDEN, Women's Prize-winning author of THE SAFEKEEP 'An intricately woven epic, Confessions is both intimate and expansive, a novel that teems with raw, hungry life' COLIN WALSH, author of KALA It is late September in 2001 and the walls of New York are papered over with photos of the missing. Cora Brady's father is there, the poster she made taped to columns and bridges. Her mother died long ago and now, orphaned on the cusp of adulthood, Cora is adrift and alone. Soon, a letter will arrive with the offer of a new life: far out on the ragged edge of Ireland, in the town where her parents were young, an estranged aunt can provide a home and fulfil a long-forgotten promise. There the story of Cora's family is hidden, and in her presence will begin to unspool... An essential, immersive debut from an astonishing new voice, Confessions traces the arc of three generations of women as they experience in their own time the irresistible gravity of the past: its love and tragedy, its mystery and redemption, and, in all things intended and accidental, the beauty and terrible shade of the things we do. 'Propulsive and utterly captivating . . . Airey has shades of the American novelists Donna Tartt and Jeffrey Eugenides in her style' IRISH TIMES 'A remarkable debut' MIRANDA COWLEY HELLER, bestselling author of THE PAPER PALACE 'A cool, bold image of female pain and liberation' GUARDIAN
Sofort per Download lieferbar
8,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Creation A1034629158
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
Sofort per Download lieferbar
9,49€
Versand: frei!
Zum Shop
buecher.de

Penguin Books UK French Three Months A1003371030
Learn to speak French in just 3 months with this practical language course for beginners! This language course in an easily portable book will teach you to speak French faster than you ever thought possible. Regular exercises and drills will reinforce your learning as you go, helping to build your confidence with your new language. The essentials of French grammar are clearly explained, while model sentences and word lists help you to learn and remember your new French vocabulary. Each chapter ends with a conversation in everyday French, based on a real-life scenario, which you can read aloud to practise your speaking skills. Intuitive pronunciation guides, using Hugo's unique "imitated pronunciation" system - which replaces French sounds with English syllables you're already familiar with - make sure that you're always confident with the pronunciation of new words. This guide also includes a mini bilingual dictionary for quick reference when you're learning or revising your new skills. Whether you're learning French for work or to feel more at home in a new country, this indispensable guide will give you confidence you need.
2 - 3 Wochen
9,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Books UK The Personal MBA A1021672592
***THE INTERNATIONAL BESTSELLER: OVER 1 MILLION COPIES SOLD WORLDWIDE*** Are you tempted to go to business school? Save your money and read THE PERSONAL MBA instead . This bestselling business classic gives you everything you need to transform your business and your career. An MBA at a top business school is an enormous investment in time and cash. And if you don't want to work for a consulting firm or an investment bank, the chances are it simply isn't worth it. The Personal MBA gives you simple mental models for every subject that's key to commercial success. From the basics of products and marketing to the nuances of teamwork and systems, this book distils everything you need to know to take on the MBA graduates and win. 'File this book under: NO EXCUSES' Seth Godin 'No matter what they tell you, an MBA is not essential. If you combine reading this book with actually trying stuff, you'll be far ahead in the business game' Kevin Kelly, founder of Wired
Sofort lieferbar
12,79€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Who's Afraid of Gender? A1072253915
An Instant Sunday Times Bestseller 'A profoundly urgent intervention' Naomi Klein From one of the most influential thinkers of our time, an enlightening, essential account of how a fear of gender is fuelling reactionary politics around the world Judith Butler, the ground-breaking philosopher whose work has redefined how we think about gender and sexuality, confronts the attacks on gender that have become central to right-wing movements today. Global networks have formed 'anti-gender ideology movements' dedicated to circulating a fantasy that gender is a dangerous threat to families, local cultures, civilization - and even 'man' himself. Inflamed by the rhetoric of public figures, this movement has sought to abolish reproductive justice, undermine protections against violence, and strip trans and queer people of their rights. But what, exactly, is so disturbing about gender? In this vital, courageous book, Butler carefully examines how 'gender' has become a phantasm for emerging authoritarian regimes, fascist formations and transexclusionary feminists, and the concrete ways in which this phantasm works. Operating in tandem with deceptive accounts of critical race theory and xenophobic panics about migration, the anti-gender movement demonizes struggles for equality and leaves millions of people vulnerable to subjugation. An essential intervention into one of the most fraught issues of our moment, Who's Afraid of Gender? is a galvanizing call to make a broad coalition with all those who struggle for equality and fight injustice. Imagining new possibilities for freedom and solidarity, Butler offers us an essentially hopeful work that is both timely and timeless.
Sofort lieferbar
14,19€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Edible Economics A1065897022
RADIO 4 BOOK OF THE WEEK Economic thinking - about globalisation, climate change, immigration, austerity, automation and much more - in its most digestible form For decades, a single free market philosophy has dominated global economics. But this is bland and unhealthy - like British food in the 1980s, when bestselling author and economist Ha-Joon Chang first arrived in the UK from South Korea. Just as eating a wide range of cuisines contributes to a more interesting and balanced diet, so too is it essential we listen to a variety of economic perspectives. In Edible Economics, Chang makes challenging economic ideas more palatable by plating them alongside stories about food from around the world. He uses histories behind familiar food items - where they come from, how they are cooked and consumed, what they mean to different cultures - to explore economic theory. For Chang, chocolate is a life-long addiction, but more exciting are the insights it offers into post-industrial knowledge economies; and while okra makes Southern gumbo heart-meltingly smooth, it also speaks of capitalism's entangled relationship with freedom and unfreedom. Explaining everything from the hidden cost of care work to the misleading language of the free market as he cooks dishes like anchovy and egg toast, Gambas al Ajillo and Korean dotori mook, Ha-Joon Chang serves up an easy-to-digest feast of bold ideas. Myth-busting, witty and thought-provoking, Edible Economics shows that getting to grips with the economy is like learning a recipe: if we understand it, we can change it - and, with it, the world.
Sofort lieferbar
14,39€
Versand: frei!
Zum Shop
buecher.de

Penguin Books UK Franklin D. Roosevelt A1048826137
From the acclaimed author of John F. Kennedy: An Unfinished Life, the biography of one of America's greatest presidents, Franklin D. Roosevelt. 'Meticulously researched and authoritative, heroically objective and wide-angled ... Roosevelt is with us again in Dallek's outstanding cradle-to-grave study' Douglas Brinkley, Washington Post 'Assuredly the best single-volume Roosevelt biography' Eric Rauchway, The Times Literary Supplement 'Essential ... a master of the presidential biography captures Roosevelt's compassion and sense of solidarity' Greg Grandin, Guardian 'An insightful, incisive and intelligent one-volume work - and a pointed primer on how things in Washington get done. In a period defined by division, Dallek crafts a pointillist portrait of the four-term president, who knew almost intuitively how to reach consensus' Peter M. Gianotti, Newsday
2 - 3 Wochen
19,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Publishing Group Contemporary Celtic Crochet A1036703239
Learn to crochet cables! Have you ever wanted to create a sweater with beautiful cables, but you didn't know how to knit? Now, in Contemporary Celtic Crochet, you can learn how to use basic crochet stitches to create the same stunning effect on sweater wraps, stoles, cardigans, and more. This book features easy projects, such as hats, scarves and device covers, and more difficult projects, including sweaters, wraps and blankets. Make the Hialeah Honey Baby Blankey to swaddle a newborn or create the Inisheer Sweater Wrap to stay cozy in cool weather. The Cables Meet Lace Cape is perfect for evenings out, and the Pennywhistler's Pack will let you carry your essentials on any day trip. These Celtic-inspired stitches and projects are the perfect addition to your crochet repertoire.
Sofort per Download lieferbar
16,49€
Versand: frei!
Zum Shop
buecher.de

Penguin Books UK Numbers Game A1022833713
Discover football's astonishing hidden rules in The Numbers Game by Chris Anderson and David Sally *Fully updated with a new World Cup chapter* Football has always been a numbers game: 4-4-2, the big number 9 and 3 points for a win. But what if up until now we've been focusing on the wrong numbers? What if the numbers that really matter, the ones that hold the key to winning matches, are actually 2.66, 53.4, 50/50, and 0 > 1? What if managers only make a 15% difference? What if Chelsea should have bought Darren Bent? In this incisive, myth-busting book, Chris Anderson, former goalkeeper turned football statistics guru, and David Sally, former baseball pitcher turned behavioural economist, show that every shred of knowledge we can gather can help us to love football and understand it even more. You'll discover why stopping a goal is more valuable than scoring one, why corners should be taken short, and why it is better to improve your worst player than to buy a superstar. You'll never play, or watch, a game of football in quite the same way again. The Numbers Game is essential reading for football fans everywhere and will also appeal to readers who loved Moneyball and Freakonomics.
1 - 2 Wochen
14,09€
Versand: frei!
Zum Shop
buecher.de

Penguin LLC US Frankenstein in Baghdad A1040122627
International Booker Prize finalist Winner of the International Prize for Arabic Fiction Brave and ingenious. The New York Times Gripping, darkly humorous . . . profound. Phil Klay, bestselling author and National Book Award winner for Redeployment Extraordinary . . . A devastating but essential read. Kevin Powers, bestselling author and National Book Award finalist for The Yellow Birds From the rubble-strewn streets of U.S.-occupied Baghdad, Hadi a scavenger and an oddball fixture at a local café collects human body parts and stitches them together to create a corpse. His goal, he claims, is for the government to recognize the parts as people and to give them proper burial. But when the corpse goes missing, a wave of eerie murders sweeps the city, and reports stream in of a horrendous-looking criminal who, though shot, cannot be killed. Hadi soon realizes he s created a monster, one that needs human flesh to survive first from the guilty, and then from anyone in its path. A prizewinning novel by Baghdad s new literary star (The New York Times), Frankenstein in Baghdad captures with white-knuckle horror and black humor the surreal reality of contemporary Iraq.
Sofort lieferbar
14,19€
Versand: frei!
Zum Shop
Osiander.de

Penguin LLC US Blueberries for Sal A1076451075
CALDECOTT HONOR BOOK NATIONAL BESTSELLER Adored by generations of readers, this gorgeously illustrated classic tells a tale of youth, curiosity, and delight as a little girl and her mother make unexpected friends while picking blueberries in the Maine countryside. One of The Atlantic’s 65 Essential Children’s Books “All the color and flavor of the sea and pine-covered Maine countryside.”—School Library Journal (starred review) Kuplink, kuplank, kuplunk! Sal and her mother are picking blueberries to can for the winter. But when Sal wanders to the other side of Blueberry Hill, she discovers a mama bear preparing for her own long winter. Meanwhile, Sal's mother is being followed by a small bear with a big appetite for berries! Will each mother go home with the right little one? With its expressive line drawings and gentle, humorous storytelling, Blueberries for Sal will have readers of all ages rooting for their adventurous protagonist to explore, reunite, and—of course—eat more blueberries!
5 - 7 Tagen
9,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Random House Italian American A1059945195
IACP AWARD FINALIST Reimagine Italian-American cooking, with more than 125 recipes rich with flavor and nostalgia from the celebrated husband-and-wife chef team of Michelin-starred Don Angie in New York City. Every bit of warmth and hospitality that you feel when you walk into Don Angie pours out of every page of this magical book. Michael Symon ONE OF THE BEST COOKBOOKS OF THE YEAR: New York Post, Minneapolis Star Tribune, Food52, Epicurious, Taste of Home The words red sauce alone conjure images of an Italian-American table full of antipasti, both hot and cold, whisked off to make room for decadent baked pastas topped with molten cheese, all before a procession of chicken parm or pork chops all pizzaiola and we haven t even gotten to dessert. It s old-school cooking beloved by many and imbued with a deep sense of family. In Italian American, Angie Rito and Scott Tacinelli, the chefs of critically acclaimed Don Angie in New York City s West Village, reinvigorate the genre with a modern point of view that proudly straddles the line between Italian and American. They present family classics passed down through generations side-by-side with creative spins and riffs inspired by influences both old and new. These comforting dishes feel familiar but are far from expected, including their signature pinwheel lasagna, ribs glazed with orange and Campari, saucy shrimp parm meatballs, and a cheesy, bubbling gratin of broccoli rabe and sharp provolone. Full of family history and recipes that will inspire a new generation, Italian American provides an essential, spirited introduction to an unforgettable way of cooking.
2 - 3 Wochen
38,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Books UK Think, Write, Speak A1057457930
'Masterly, hilarious, truly insightful' - Philip Hensher, The Spectator A Times Literary Supplement Book of the Year 2019 The last major collection of Nabokov's published material, Think, Write, Speak brings together a treasure trove of previously uncollected texts from across the author's extraordinary career. Each phase of his wandering life is included, from a precocious essay written while still at Cambridge in 1921, through his fame in the aftermath of the publication of Lolita to the final, fascinating interviews given shortly before his death in 1977. Introduced and edited by his biographer Brian Boyd, this is an essential work for anyone who has been drawn into Nabokov's literary orbit. Here he is at his most inspirational, curious, playful, misleading and caustic. The seriousness of his aesthetic credo, his passion for great writing and his mix of delight and dismay at his own, sudden global fame in the 1950s are all brilliantly delineated.
Sofort lieferbar
16,09€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Moral AI A1071845960
A balanced and thought-provoking guide to all the big questions about AI and ethics Can computers understand morality? Can they respect privacy? And what can we do to make AI safe and fair? The artificial intelligence revolution has begun. Today, there are self-driving cars on our streets, autonomous weapons in our armies, robot surgeons in our hospitals - and AI's presence in our lives will only increase. Some see this as the dawn of a new era in innovation and ease; others are alarmed by its destructive potential. But one thing is clear: this is a technology like no other, one that raises profound questions about the very definitions of human intelligence and morality. In Moral AI, world-renowned researchers in moral psychology, philosophy, and artificial intelligence - Jana Schaich Borg, Walter Sinnott-Armstrong and Vincent Conitzer - tackle these thorny issues head-on. Writing lucidly and calmly, they lay out the recent advances in this still nascent field, peeling away the exaggeration and misleading arguments. Instead, they offer clear examinations of the moral concerns at the heart of AI programs, from racial equity to personal privacy, fake news to autonomous weaponry. Ultimately, they argue that artificial intelligence can be built and used safely and ethically, but that its potential cannot be achieved without careful reflection on the values we wish to imbue it with. This is an essential primer for any thinking person.
Sofort lieferbar
11,79€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Feline Philosophy A1060182073
'Why can't a human be more like a cat? That is the question threaded through this vivid patchwork of philosophy, fiction, history and memoir ... a wonderful mixture of flippancy and profundity, astringency and tenderness, wit and lament' Jane O'Grady, Daily Telegraph 'When I play with my cat, how do I know she is not passing time with me rather than I with her?' Montaigne There is no real evidence that humans ever 'domesticated' cats. Rather, it seems that at some point cats saw the potential value to themselves of humans. John Gray's wonderful new book is an attempt to get to grips with the philosophical and moral issues around the uniquely strange relationship between ourselves and these remarkable animals. Feline Philosophy draws on centuries of philosophy, from Montaigne to Schopenhauer, to explore the complex and intimate links that have defined how we react to and behave with this most unlikely 'pet'. At the heart of the book is a sense of gratitude towards cats as perhaps the species that more than any other - in the essential loneliness of our position in the world - gives us a sense of our own animal nature.
Sofort lieferbar
14,09€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd Attensity! A1076324705
'Pay attention: If you are human, you must read this book' Jaron Lanier We all feel it: something is seriously wrong. Our attention-that essential ability to give our minds and senses to the world-is being trapped, gutted, and sold out from under us by an industry of immense technological and financial power. The heedless exploitation of this vital capacity by a handful of tech companies is harming us all, reducing our very selfhood to that which can be quantified, bought, and sold-and shaking the foundations of our democracy. To push back against this 'human fracking,"'we need more than individual willpower or isolated efforts. We need a movement of collective resistance. Such a movement is beginning to bloom, and in this radical, first-of-its-kind guide, The Friends of Attention show us how to join the fight. We meet welders, nurses, poets, and surfers, all of whom are engaged in attentional practices. We learn to seek out sanctuaries-theatres and museums, houses of worship, dance parties-where together we can take refuge from the frackers. Drawing on a rich legacy of critical intellectuals and the creative wisdom of diverse traditions, Attensity! takes our apocalyptic present, turns it on its head, and reveals new vistas of human flourishing.
Sofort lieferbar
18,99€
Versand: frei!
Zum Shop
buecher.de

Penguin Books Ltd The Feminine Mystique A1008450800
'One of the most influential non-fiction books of the twentieth century' The New York Times When Betty Friedan produced The Feminine Mystique in 1963, she could not have realized how the discovery and debate of her contemporaries' general malaise would shake up society. Victims of a false belief system, these women were following strict social convention by loyally conforming to the pretty image of the magazines, and found themselves forced to seek meaning in their lives only through a family and a home. Friedan's controversial book about them - and every woman - would ultimately set Second Wave feminism in motion and begin the battle for equality. This groundbreaking and life-changing work remains just as powerful, important and true as it was nearly fifty years ago, and is essential reading both as a historical document and as a study of women living in a man's world.
Sofort lieferbar
10,79€
Versand: frei!
Zum Shop
buecher.de